<?xml version="1.0" encoding="UTF-8"?>
<rss version="2.0"
	xmlns:content="http://purl.org/rss/1.0/modules/content/"
	xmlns:wfw="http://wellformedweb.org/CommentAPI/"
	xmlns:dc="http://purl.org/dc/elements/1.1/"
	xmlns:atom="http://www.w3.org/2005/Atom"
	xmlns:sy="http://purl.org/rss/1.0/modules/syndication/"
	xmlns:slash="http://purl.org/rss/1.0/modules/slash/"
	>

<channel>
	<title>~larcher &#187; science</title>
	<atom:link href="http://spoon.cx/~larcher/category/science/feed/" rel="self" type="application/rss+xml" />
	<link>http://spoon.cx/~larcher</link>
	<description>Larry Archer's irregular weblog</description>
	<lastBuildDate>Wed, 08 Feb 2012 16:03:25 +0000</lastBuildDate>
	<language>en</language>
	<sy:updatePeriod>hourly</sy:updatePeriod>
	<sy:updateFrequency>1</sy:updateFrequency>
	<generator>http://wordpress.org/?v=3.3.1</generator>
		<item>
		<title>Dorkbot Austin!</title>
		<link>http://spoon.cx/~larcher/2006/07/14/dorkbot-austin/?utm_source=rss&#038;utm_medium=rss&#038;utm_campaign=dorkbot-austin</link>
		<comments>http://spoon.cx/~larcher/2006/07/14/dorkbot-austin/#comments</comments>
		<pubDate>Fri, 14 Jul 2006 06:10:08 +0000</pubDate>
		<dc:creator>larcher</dc:creator>
				<category><![CDATA[austin]]></category>
		<category><![CDATA[geek]]></category>
		<category><![CDATA[hardware]]></category>
		<category><![CDATA[science]]></category>

		<guid isPermaLink="false">http://spoon.cx/~larcher/blog/?p=496</guid>
		<description><![CDATA[Natalie and I went out dorking tonight The dorkbot made it&#8217;s second appearance in Austin tonight at Cafe Mundi. There was some great geeking going on .. I think we missed the first presentation though (got there around 8:30). First one we saw was Joel Greenberg showing off his nifty homemade mic zeppelin. According to [...]]]></description>
			<content:encoded><![CDATA[<p>Natalie and I went out dorking tonight <img src='http://spoon.cx/wordpress/wp-includes/images/smilies/icon_smile.gif' alt=':)' class='wp-smiley' />   The <a href="http://dorkbot.org/dorkbotaustin/">dorkbot</a> made it&#8217;s second appearance in Austin tonight at <a href="http://www.cafemundi.com/">Cafe Mundi</a>.   There was some great geeking going on .. I think we missed the first presentation though (got there around 8:30).  </p>
<p>First one we saw was Joel Greenberg showing off his nifty homemade <a href="http://www.joelandkaren.com/mic-zeppelin/">mic zeppelin</a>.  According to my del.icio.us links, I read about this back in April, but didn&#8217;t realize he was from Austin.  (Note to self: checkout his <a href="http://friendstalking.joelandkaren.com/">podcast</a> )</p>
<p>Next up was  Rich LeGrand and his <a href="http://www.charmedlabs.com">Lego-bot with a Gameboy brain</a>.  Basically, he put an FPGA and some flash memory on a card that fits in the Gameboy Advance cartridge slot, which lets the GBA brain talk to sensors and motor controllers and cameras and all kinds of roboty goodness.  For a demo, the bot spotted a loose lego piece, wheeled itself over, grabbed the piece, and moved it to the other side of the table.   It was also able to learn and repeat and little dance &#8212; you push the thing around the table, and it senses the movement through the motors, records it, and plays it back.  ( <a href="http://www.youtube.com/watch?v=s1aBDbvEX9o">video!</a> )</p>
<p>The Austin <a href="http://www.robotgroup.net/">Robot Group</a> had the last two presentations:  Eric Lundquist  explained the <a href="http://www.robotgroup.net/index.cgi/BabblingHead">Babbling Head</a> and had it sing a few songs, and Vern Graner demoed  the controller board/prototype of a funky spin-art game-type-thing they&#8217;re making for the next <a href="http://www.firstnightaustin.org/">First Night Austin</a>.</p>
<p>All kinds of Neat Stuff[tm] .. we&#8217;ll have to go back next month.  (I heard they had a homemade Tesla coil last month!)  I managed to catch part of the evening with the voice recorder on my iAudio.  I&#8217;ll try to clean it up and stick it online sometime in the next few days. </p>
<p>[tags] austin, austintx, geek, dorkbot, dorkbotaustin, nerd, robots, robotics[/tags]</p>
]]></content:encoded>
			<wfw:commentRss>http://spoon.cx/~larcher/2006/07/14/dorkbot-austin/feed/</wfw:commentRss>
		<slash:comments>1</slash:comments>
		</item>
		<item>
		<title>Mars Attacks!</title>
		<link>http://spoon.cx/~larcher/2003/08/28/mars-attacks/?utm_source=rss&#038;utm_medium=rss&#038;utm_campaign=mars-attacks</link>
		<comments>http://spoon.cx/~larcher/2003/08/28/mars-attacks/#comments</comments>
		<pubDate>Thu, 28 Aug 2003 00:11:00 +0000</pubDate>
		<dc:creator>larcher</dc:creator>
				<category><![CDATA[science]]></category>

		<guid isPermaLink="false">http://www.spoon.cx/~larcher/blog/index.cgi/geek/science/close-mars.html</guid>
		<description><![CDATA[That&#8217;s right, the Communist Red Planet is closer to Earth now than it has been in the past 60,000 years. Look for the bright red thing in the east after sunset. ( I really should buy a telescope one of these days. ) The Astronomy Picture of the Day has plenty of information and linkification. [...]]]></description>
			<content:encoded><![CDATA[<p>That&#8217;s right, the <strike>Communist</strike> Red Planet is closer to Earth now than it has been in the past 60,000 years.  Look for the bright red thing in the east after sunset.  ( I really should buy a telescope one of these days. )<br />
The <a HREf="http://antwrp.gsfc.nasa.gov/apod/ap030827.html">Astronomy Picture of the Day</a> has plenty of information and linkification.  If you want to know exactly when sunset is tonight, you could consult the <a HREF="http://aa.usno.navy.mil/data/docs/RS_OneDay.html">US Naval Observatory&#8217;s website</a>.  </p>
]]></content:encoded>
			<wfw:commentRss>http://spoon.cx/~larcher/2003/08/28/mars-attacks/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>The virus that causes SARS has &lt;A HREF=&quot;http://weblog.soulhuntre.com/archives/001417.ascx&quot;&gt;made it online&lt;/A&gt;.</title>
		<link>http://spoon.cx/~larcher/2003/05/05/the-virus-that-causes-sars-has-a-hrefhttpweblogsoulhuntrecomarchives001417ascxmade-it-onlinea/?utm_source=rss&#038;utm_medium=rss&#038;utm_campaign=the-virus-that-causes-sars-has-a-hrefhttpweblogsoulhuntrecomarchives001417ascxmade-it-onlinea</link>
		<comments>http://spoon.cx/~larcher/2003/05/05/the-virus-that-causes-sars-has-a-hrefhttpweblogsoulhuntrecomarchives001417ascxmade-it-onlinea/#comments</comments>
		<pubDate>Mon, 05 May 2003 20:36:00 +0000</pubDate>
		<dc:creator>larcher</dc:creator>
				<category><![CDATA[science]]></category>

		<guid isPermaLink="false">http://www.spoon.cx/~larcher/blog/index.cgi/geek/science/sars-genome.html</guid>
		<description><![CDATA[It starts like this: ATATTAGGTTTTTACCTACCCAGGAAAAGCCAACCAACCTCGATCTCTTG TAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTAGCTGTCGCTCGGC TGCATGCCTAGTGCACCTACGCAGTATAAACAATAATAAATTTTACTGTC GTTGACAAGAAACGAGTAACTCGTCCCTCTTCTGCAGACTGCTTACGGTT ... (via NSLog) a related news item]]></description>
			<content:encoded><![CDATA[<p>It starts like this:<br />
<br />
<tt><br />
ATATTAGGTTTTTACCTACCCAGGAAAAGCCAACCAACCTCGATCTCTTG<br />
TAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTAGCTGTCGCTCGGC<br />
TGCATGCCTAGTGCACCTACGCAGTATAAACAATAATAAATTTTACTGTC<br />
GTTGACAAGAAACGAGTAACTCGTCCCTCTTCTGCAGACTGCTTACGGTT<br />
... </tt></p>
<p>(via <a HREF="http://nslog.com/archives/2003/05/05/the_sars_genome.php">NSLog</a>)</p>
<p>a related <a href="http://news-info.wustl.edu/news/page/normal/201.html">news item</a></p>
]]></content:encoded>
			<wfw:commentRss>http://spoon.cx/~larcher/2003/05/05/the-virus-that-causes-sars-has-a-hrefhttpweblogsoulhuntrecomarchives001417ascxmade-it-onlinea/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
	</channel>
</rss>

